View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12684_high_6 (Length: 338)
Name: NF12684_high_6
Description: NF12684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12684_high_6 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 16 - 157
Target Start/End: Original strand, 1132230 - 1132372
Alignment:
| Q |
16 |
atgaattaacaaatatgaagcaagatgagcggaacttccaaatgaagcttctc-tcgaggtgcttttccaacccctctcttatgcattcgggggtgccct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1132230 |
atgaattaacaaatatgaagcaagatgagcggaacttccaaatgaagcttctcctcgaggtgcttttccaacccctctcttatgcattcgggggtgccct |
1132329 |
T |
|
| Q |
115 |
ccttagagttggctcatgtctgctatcaggccttttgtcctcg |
157 |
Q |
| |
|
|||| |||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
1132330 |
cctttgagttggctcatatctgctataaggctttttgtcctcg |
1132372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 185 - 323
Target Start/End: Original strand, 1132453 - 1132588
Alignment:
| Q |
185 |
acaacaaggatgatgatgacgacaacgatgacaaaaaatattttaaaataagattgttactaaatataatgatcaattgagtgagcaaaaagacaaacac |
284 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1132453 |
acaacaaggatgatgatgac---aacgatgacaaacaatattttaaaataagatcgttactaaagatactgatcaattgagtgagcaaaaagacaaacac |
1132549 |
T |
|
| Q |
285 |
gacacattgatattcaagagacatcaaatagttattatt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1132550 |
cacacattgatattcaagagacatcaaatagttattatt |
1132588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0212 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 42 - 141
Target Start/End: Complemental strand, 1177 - 1078
Alignment:
| Q |
42 |
gagcggaacttccaaatgaagcttctctcgaggtgcttttccaacccctctcttatgcattcgggggtgccctccttagagttggctcatgtctgctatc |
141 |
Q |
| |
|
|||||||||||| || ||||||||||| || ||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1177 |
gagcggaacttctaactgaagcttctcacggggtccttttccaacccctctcttatgcgttcgggggtgccctcctttgagttggctcatgtctgctatc |
1078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 137 - 165
Target Start/End: Complemental strand, 54352 - 54324
Alignment:
| Q |
137 |
ctatcaggccttttgtcctcgtaagcaac |
165 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54352 |
ctatcaggccttttgtcctcgtaagcaac |
54324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University