View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12684_high_9 (Length: 252)
Name: NF12684_high_9
Description: NF12684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12684_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 234
Target Start/End: Original strand, 44546253 - 44546474
Alignment:
| Q |
13 |
gagatgaaccctagaaagagaacatgggatcatgaaaaagatttatatgatttccttcttcttcacaagattaggtaccctaatactcaaaagaaaaagc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44546253 |
gagaagaaccctagaaagagaacatgggatcatgaaaaagatttatatgatttccttcttc---acaagattagggaccctaatactcaaaagaaaaagc |
44546349 |
T |
|
| Q |
113 |
tctacaaccttc---ttcacaaattttacattaacgatccaaaagccgactcagacttgataaagatcacagatggtccatccagtattatacaatctca |
209 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546350 |
tctacgaccttcttcttcacaaattttacattaacgatccaaaagccgactcagacttgataaagatcacagatggtccatccagtattatacaatctca |
44546449 |
T |
|
| Q |
210 |
gctgcttcatcttcaggaacaaaac |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44546450 |
gctgcttcatcttcaggaacaaaac |
44546474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University