View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12684_low_6 (Length: 529)
Name: NF12684_low_6
Description: NF12684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12684_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 461; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 461; E-Value: 0
Query Start/End: Original strand, 18 - 514
Target Start/End: Original strand, 13792786 - 13793282
Alignment:
| Q |
18 |
tttatatcgtttgaaagttcgagaatcttcttctttcttagcgtgtgattcatgtcaaggtttttcgttgagaataaaaggttgttacagatttttctaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
13792786 |
tttatatcgtttgaaagttcgagaatcttcttctttcttagcgtgtgattcatgtcaaggtttttggtcgagaataaaaggttgttacatatttttctaa |
13792885 |
T |
|
| Q |
118 |
ggtctttccagcgttgagagataggtataaatggtaaactgtagttatggtggtttgcacctttcattgcatcggggattgttctattagagagagattg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13792886 |
ggtctttccagcgttgagagataggtataaatggtaaactgtaattatggtggttagcacctttcattgcatcggggattgttctattagagagagaatg |
13792985 |
T |
|
| Q |
218 |
gtcgttgatttgaaggactgatttgacggtttctgtggaggacataactatggtagttattcggcccaattttaaggacattattgggccgtggattttg |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13792986 |
gtcgttgatttgaaggactgatttgacagtttctgtggaggacataactatggtagttattcggcccaattttaaggacattattgggccgtggattttg |
13793085 |
T |
|
| Q |
318 |
gagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtggaagtcgaggtttgtgtt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793086 |
gagagttttgcgagggtttggtggggcttttgacccagttgatggagattgcctatgatggggaggccacgtggacccggtggaagtcgaggtttgtgtt |
13793185 |
T |
|
| Q |
418 |
ttatgagaaaggaatagaggatttggaggaagatgaagatgaagagaatgaggagtgtggtgttgagtgtgtccatttgttgttgttgttttggcag |
514 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13793186 |
ttatgagaaaggaatagaggatttggaggaagatgaagatgaagagaatgaggagtgtagtgttgagtgtgtccatttgttgttgttgttgtggcag |
13793282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University