View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12685_low_10 (Length: 233)
Name: NF12685_low_10
Description: NF12685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12685_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 233
Target Start/End: Original strand, 6111149 - 6111371
Alignment:
| Q |
11 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111149 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
6111248 |
T |
 |
| Q |
111 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactcaccaatgttaagtgcaaccgagtgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111249 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactcaccaatgttaagtgcaaccgagtgaa |
6111348 |
T |
 |
| Q |
211 |
catcaatatcaattgaaacatgc |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6111349 |
tatcaatatcaattgaaacatgc |
6111371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University