View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12686_low_13 (Length: 209)
Name: NF12686_low_13
Description: NF12686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12686_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 209
Target Start/End: Complemental strand, 45706558 - 45706356
Alignment:
| Q |
7 |
tattcatcatcagtatagtaaataagagaattataattatacatgagttattagattatcactaatcaactttttacgctctataattgcagcatcagca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45706558 |
tattcatcatcagtatagtaaataagagaattataattatacgtgagttattagattatcactaatcaactttttacgctctataattgcagcatcagca |
45706459 |
T |
 |
| Q |
107 |
agaagatgaagccagcacaacattgatccgattattatatctttcaataattttctttctgttaatgtatttgttgtgagaattagatagttgggttttg |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
45706458 |
agaagatgaagctagcacaacattgatccgattattatatctttcaataattttctttctgttaatgtatttgtagtgagaattagctagttgggttttg |
45706359 |
T |
 |
| Q |
207 |
ttt |
209 |
Q |
| |
|
||| |
|
|
| T |
45706358 |
ttt |
45706356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University