View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12687_high_2 (Length: 366)
Name: NF12687_high_2
Description: NF12687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12687_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 30 - 289
Target Start/End: Original strand, 17581910 - 17582161
Alignment:
| Q |
30 |
cagaatcattgctaaccttcgtaacaaaaacaaatcactggtcatttgataaatatgccaagttagataattttatgatgactgatgagaggtctgtcct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17581910 |
cagaatcattgctaaccttcgtaacaaaaacaaatcactggt--------aaatatgctaagttagataattttatgatgactgatgagaggtctgtcct |
17582001 |
T |
 |
| Q |
130 |
tgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgactgtcggtatnnnnnnntgtttacagtgaaaggtatatctgaatta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
17582002 |
tgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgaccgtcgttataaaaaaatgtttacagtgaaaggtatatctgaatta |
17582101 |
T |
 |
| Q |
230 |
aatcaaaataaaaaatgatggttcaagagatttgctttctcatccaatatggtaactgca |
289 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17582102 |
aatcaaaataaaaaatgatagttcaagagttttgctttctcatccaatatggtaactgca |
17582161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 318 - 356
Target Start/End: Original strand, 17582163 - 17582201
Alignment:
| Q |
318 |
ccattttggaggttgcccctaagatagcacaggttctgc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17582163 |
ccattttggaggttgcccctaagatagcacaagttctgc |
17582201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 203 - 348
Target Start/End: Complemental strand, 14745292 - 14745143
Alignment:
| Q |
203 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagatttgctttctcatccaat----atggtaactgcagtctagtct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
14745292 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatgcaatatgcatggtaactgtagtctagtct |
14745193 |
T |
 |
| Q |
299 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14745192 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
14745143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 184
Target Start/End: Original strand, 53896354 - 53896391
Alignment:
| Q |
147 |
aggcaaggagttttcatcatcaaactgttacgattgac |
184 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
53896354 |
aggcaaggagttttcaccaacaaactgttacgattgac |
53896391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 53896417 - 53896445
Alignment:
| Q |
207 |
cagtgaaaggtatatctgaattaaatcaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53896417 |
cagtgaaaggtatatctgaattaaatcaa |
53896445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University