View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12687_high_3 (Length: 344)
Name: NF12687_high_3
Description: NF12687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12687_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 50 - 322
Target Start/End: Original strand, 16012793 - 16013064
Alignment:
| Q |
50 |
agaatagcgtagcggagtgaatggagctgaaactgcaacgagcgtagtgcagctagattgccttccgcttaagtttggcccatacatatgttgggttacg |
149 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16012793 |
agaatagcgtagcgaagtgaatggagctgaaactgcaacgagcgtagtgcagctagagtgccttccgcttaagtttggcccatacatatgttgggttaag |
16012892 |
T |
|
| Q |
150 |
attaggagggttggggtatagtgggcgaagcccctcgcattggaatttaagggtaaacttgaccgtagtatttaaacataacttgtaatctgcaactgta |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16012893 |
attaggagggttggggtatagtgggcgaagtccctcgcattgcaatttaagggtaaacttgaccgtagtatttaaacataacttgtaatctgcaactgca |
16012992 |
T |
|
| Q |
250 |
agagtttcatagtagaaactacagtagccactctattgtcggagacgtagggcacacttgctcgaactctgtg |
322 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
16012993 |
agaatttcatagtagaaactacagtagccactctattgtcggagtcgta-ggcacacttgctcgaactctgtg |
16013064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 202 - 241
Target Start/End: Complemental strand, 13855090 - 13855051
Alignment:
| Q |
202 |
gtaaacttgaccgtagtatttaaacataacttgtaatctg |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
13855090 |
gtaaactagaccgtagtatttaaacataagttgtaatctg |
13855051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University