View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12688_high_10 (Length: 241)
Name: NF12688_high_10
Description: NF12688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12688_high_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 49833470 - 49833692
Alignment:
| Q |
19 |
atggagcaatgggagatttcaggctgttacacatagagtggtgacaagaggagacaaagagagacttgcttttattctttttggagtgccaaaggaagat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49833470 |
atggagcaatgggagatttcaggctgttacacatagagtggtgacaaggggagacaaagagagacttgcttttattctttttggagtgccaaaggaagat |
49833569 |
T |
|
| Q |
119 |
gcagtcattaaggtgccctctgagttggtggatgacaaagatcaccctcttcattatcgtccatttaagtatgaggagttcatagattatcattattcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49833570 |
gcagtcattaaggtgccctctgagttggtggatgacaaagatcaccctcttcattatcgcccatttaagtatgaggagttcatagattatcattattcaa |
49833669 |
T |
|
| Q |
219 |
ctcgcactgaaaaggcagtactt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49833670 |
ctcgcactgaaaaggcagtactt |
49833692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 53 - 207
Target Start/End: Complemental strand, 6930194 - 6930040
Alignment:
| Q |
53 |
agagtggtgacaagaggagacaaagagagacttgcttttattctttttggagtgccaaaggaagatgcagtcattaaggtgccctctgagttggtggatg |
152 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| |||| ||||||||| | | | | ||||||||| || || ||| ||||||||||||| |||||||||| |
|
|
| T |
6930194 |
agagtggtcacaaggggagacaaagagagaattgcatttattcttatggcaattccaaaggaaaatatggttattgaggtgccctctgaattggtggatg |
6930095 |
T |
|
| Q |
153 |
acaaagatcaccctcttcattatcgtccatttaagtatgaggagttcatagatta |
207 |
Q |
| |
|
| || |||||||||| | ||| || || |||||||||||||||| |||| |||| |
|
|
| T |
6930094 |
atgaaaatcaccctctccgttaccggccttttaagtatgaggagtacatacatta |
6930040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University