View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12688_high_8 (Length: 276)
Name: NF12688_high_8
Description: NF12688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12688_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 22 - 258
Target Start/End: Complemental strand, 30246602 - 30246362
Alignment:
| Q |
22 |
taagttgagagttaaatgtcattgtcaagtgttttttaatataattctttttcttttctatattgctt----tgcctcaaagtcctcttttatttcacgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30246602 |
taagttgagagttaaatgtcattgtcaagtgttttttaatataattctttttcttttctatattgcttgctttgcctcaaagtcctcttttatttcacgg |
30246503 |
T |
 |
| Q |
118 |
tacacgaaattaattaaccattttacgaataattatcacaatctcttgaatatatggttctcgacatgatgagacttgagcagttagtttggctactaaa |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30246502 |
tacatgaaattaattaaccattttacgaataattatcacaatctcttgaatatatggttctcgacatgatgagacttgagcagttagtttggctactaaa |
30246403 |
T |
 |
| Q |
218 |
attgaaacctagctatatgtctgattatatatgtctaatta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30246402 |
attgaaacctagctatatgtctgattatatatgtctaatta |
30246362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University