View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12688_low_11 (Length: 247)
Name: NF12688_low_11
Description: NF12688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12688_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 4395467 - 4395248
Alignment:
| Q |
11 |
tgagatgaaccaaaacaattatttgtnnnnnnnctatatgtattgaaactacaccacaaaaccttgtatttgctaattatggagtcaatgggagaagatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395467 |
tgagatgaaccaaaacaattatttgtaaaaaa-ctatatgtattgaaactacaccacaaaaccttgtatttgctaattatggagtcaatgggagaagatc |
4395369 |
T |
|
| Q |
111 |
cgggtcaaatgggtttgtttcttaattgaagtaatggtgagccatatgagtgatttattctagtagtatacgcaatatgcatcatgcatgtcaatggaag |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4395368 |
cgggtcaaacgggtttgtttcttaattgaagttatggtgagccatatgagtgatttatactagtagtatacgcaatatgcatcatgcatgtccatggaag |
4395269 |
T |
|
| Q |
211 |
aaaactcagtattttgttttg |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4395268 |
aaaactcagtattttgttttg |
4395248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University