View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12688_low_18 (Length: 205)
Name: NF12688_low_18
Description: NF12688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12688_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 20925978 - 20926159
Alignment:
| Q |
1 |
cttctcctcagccataattttaggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20925978 |
cttctcctcagccataattttaggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattcataa |
20926077 |
T |
|
| Q |
101 |
atatacaaaccaagttttgtgctagtctcaccaannnnnnnatttccatgactacccttttcccttttattctcatcaacaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20926078 |
atatacaaaccaagttttgtgctagtctcaccaatttttttatttccatgactaccctttacccttttattctcatcaacaa |
20926159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 112
Target Start/End: Complemental strand, 40689757 - 40689668
Alignment:
| Q |
23 |
ggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattcataaatatacaaacca |
112 |
Q |
| |
|
||||| ||||||||||| || || ||||| | |||||||| ||||| || |||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
40689757 |
ggtttcttgtgacttgctctatggccaccaagggcttgaaatgaagggaatgttctgttgcatgttttgcattcataaacatagaaacca |
40689668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 97
Target Start/End: Original strand, 7687872 - 7687946
Alignment:
| Q |
23 |
ggttttttgtgacttgccctgtgaccacccaaagcttgaaaagaaggaaaagttctgttacatgttttgcattca |
97 |
Q |
| |
|
||||| |||||||||||||| |||||||| | |||||||| |||||||| ||| ||||||||||| |||||| |
|
|
| T |
7687872 |
ggtttcttgtgacttgccctatgaccacctagggcttgaaatgaaggaaattgtctattacatgttttacattca |
7687946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University