View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12688_low_6 (Length: 413)
Name: NF12688_low_6
Description: NF12688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12688_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 16 - 173
Target Start/End: Original strand, 6640374 - 6640531
Alignment:
| Q |
16 |
attattaactctacacttttaacttttgaatttattactcgatcaagttgaaagcttgcagatgtctgcgctctgcagaatgagaagatgggtacattga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640374 |
attattaactctacacttttaacttttgaatttattactcgatcaagttgaaagcttgcagatctctgcgctctgcagaatgagaagatgggtacattga |
6640473 |
T |
 |
| Q |
116 |
aagagctcatacccgatgcaacaaggcttatgaatgctagagttttccaagtttcttc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640474 |
aagagctcatacccgatgcaacaaggcttatgaatgctagagttttccaagtttcttc |
6640531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 238 - 402
Target Start/End: Original strand, 6640596 - 6640751
Alignment:
| Q |
238 |
gtcttatagacggataaattatcttacatgcttgatgatgccgtcatgaggagctttttcatgcatcagaagaggagtcgtgtttcagcagtttcagcaa |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6640596 |
gtcttatagacggataaattatcttacatgcttgatgatgccgtcatgaggagctttttcatgcatcagaagaggagtcgt---------gtttcagcaa |
6640686 |
T |
 |
| Q |
338 |
tttatggagtctttttcacaatgtcagtcacatctacctctgttaagatccatctcatccttcat |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640687 |
tttatggagtctttttcacaatgtcagtcacatctacctctgttaagatccatctcatccttcat |
6640751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 335 - 377
Target Start/End: Complemental strand, 8730453 - 8730411
Alignment:
| Q |
335 |
caatttatggagtctttttcacaatgtcagtcacatctacctc |
377 |
Q |
| |
|
|||||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
8730453 |
caatttatggagtctttttcaccaggtcattcacatctacctc |
8730411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University