View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12689_high_1 (Length: 514)
Name: NF12689_high_1
Description: NF12689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12689_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 222 - 490
Target Start/End: Original strand, 42932127 - 42932395
Alignment:
| Q |
222 |
tgtaagtaccttgcctaataaacttttcatgtgatgcataaagtaggtgtttttctcaactaatatcaatatccattgaatgattttaggtatctatgcc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42932127 |
tgtaagtaccttgcctaataaacttttcatgtgatgcataaagtaggtgttttcctcaactaatatcaatatccattgaatgattttaggtatctttgcc |
42932226 |
T |
|
| Q |
322 |
ctaaagggggttgcagagaaatcaatggttatcctgcagattgttcgtaagttttaaatcatcatgtttctaattgcgtcgtgatgcttatcctgttatc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932227 |
ctaaagggggttgcagagaaatcaatggttatcctgcagattgttcgtaagttttaaatcatcatgtttctaattgcgtcgtgatgcttatcctgttatc |
42932326 |
T |
|
| Q |
422 |
attttcacaataactaaagttggttgcttcatccttaatcaggtttggaactgtttctgcaaatgtgat |
490 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932327 |
attttaacaataactaaagtcggttgcttcatccttaatcaggtttggaactgtttctgcaaatgtgat |
42932395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 31 - 223
Target Start/End: Original strand, 42930942 - 42931156
Alignment:
| Q |
31 |
tcctccagtagatgcagaaggtagtggcaatgatgggcctattttcggtgagtctgatcccccgtcgccagtggtgatggaggagtggcatgat-gggtc |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
42930942 |
tcctctagtagatgcagaaggtagtggcaatgatgggcctatttccggtgtgtctgatcccccgtcgccagtggtgatggaggagtgccatgatggggtc |
42931041 |
T |
|
| Q |
130 |
tcccgaagctgcagctccaatatcgaa---------------------aaatgggagggccagcgcacccaatgatccggcgacagatgacggcggagtg |
208 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42931042 |
tcccgaagctgcagctccaatatcggaaaatggggtgggaggccatggaaatgggagggccaacgcacccaatgatccggcgacagatgacggcggagtg |
42931141 |
T |
|
| Q |
209 |
aggtggtgcgcggtg |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42931142 |
aggtggtgcgcggtg |
42931156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University