View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_1D_high_12 (Length: 239)
Name: NF1268_1D_high_12
Description: NF1268_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_1D_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 54 - 222
Target Start/End: Original strand, 52583745 - 52583930
Alignment:
| Q |
54 |
aaataatttatacataaacacttatttgataaactctagcacttaatt------------cgaatactactcaagtatgatgcaattttctttattagta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583745 |
aaataatttatacataaacacttatttgataaactctagcacttaattaagctttttattcgaatactactcaagtatgatgcaattttctttattagta |
52583844 |
T |
 |
| Q |
142 |
ctagtgaacataaaatcag-----gaagagaagaccaaccaacctcatccaacaatgaaatgagctttgcaattttgacttgatgt |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583845 |
ctagtgaacataaaatcaggaagagaagagaagaccaaccaacctcatccaacaatgaaatgagctttgcaattttgacttgatgt |
52583930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 47269486 - 47269536
Alignment:
| Q |
9 |
ccatatcaacaacagtactcagtgattggtgatcactatattcagaaataa |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47269486 |
ccatatcgacaacagtactcagtgattggtgatcactgtattcagaaataa |
47269536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University