View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1268_1D_high_14 (Length: 226)

Name: NF1268_1D_high_14
Description: NF1268_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1268_1D_high_14
NF1268_1D_high_14
[»] chr7 (1 HSPs)
chr7 (3-202)||(32195787-32195986)


Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 3 - 202
Target Start/End: Complemental strand, 32195986 - 32195787
Alignment:
3 tagattatactaaggttagtgaggttttagataaattattgatattgttaatttgttgtagtgttgttggattagttctgttgttggtagattccaagaa 102  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32195986 tagattctactaaggttagtgaggttttagataaattattgatattgttaatttgttgtagtgttgttggattagttctgttgttggtagattccaagaa 32195887  T
103 ccggtttctttgtgttgnnnnnnnatgaattgctatttctcgggttagggaggttgtagtgatatgatgctatgtagcaccaacgtgacaagtttgatca 202  Q
    |||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||    
32195886 ccggtttctttgtgttgtttttttatgaattgctatttctcgggttagggaggttgtagtgatatgatgctatgtagcaccaacatgacaagtctgatca 32195787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University