View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_1D_low_10 (Length: 415)
Name: NF1268_1D_low_10
Description: NF1268_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_1D_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 64 - 369
Target Start/End: Complemental strand, 25707636 - 25707329
Alignment:
| Q |
64 |
gtattacactatgtgcatgtttggaactaggatgtctagtttttgtctccgaatgtgatttttacattgatgtttgtttggtt--gtttctatacagata |
161 |
Q |
| |
|
|||| |||||||||||||||||| || | |||||||||||||||||||||||||||||| | |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25707636 |
gtatcacactatgtgcatgtttgaaatcaagatgtctagtttttgtctccgaatgtgattctgacatcgatgtttgtttggttttgtttctatacagata |
25707537 |
T |
|
| Q |
162 |
cgagtattgttcctcctcttatctatgctgtgatgggaagctcaagagacattgcaattggacctgtagctgtagtgtctatgcttttatcttccttggt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25707536 |
cgagtattgttcctcctcttatctatgctgtgatgggaagctcaagagacattgcaattggacctgtagctgtagtgtctatgcttttatcttccttggt |
25707437 |
T |
|
| Q |
262 |
caccaatgtcatagatcctgttgctaatcctcatgcctatagagattttatctttaccgtcaccttcttcgccggaatttttcaagctgcatttggtatt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25707436 |
caccaatgtcatagatcctgttgctaatcctcatgcctatagagattttatctttaccgtcaccttcttcaccggaatttttcaagctgcatttggtatt |
25707337 |
T |
|
| Q |
362 |
ttcaggtg |
369 |
Q |
| |
|
|||||||| |
|
|
| T |
25707336 |
ttcaggtg |
25707329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 170 - 258
Target Start/End: Complemental strand, 33270784 - 33270696
Alignment:
| Q |
170 |
gttcctcctcttatctatgctgtgatgggaagctcaagagacattgcaattggacctgtagctgtagtgtctatgcttttatcttcctt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
33270784 |
gttcctcctcttatctatgctgtgatggggagttcaagagaaattgcaattggacctgtagccgtagtgtcactgctgctatcttcctt |
33270696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University