View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_1D_low_33 (Length: 204)
Name: NF1268_1D_low_33
Description: NF1268_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_1D_low_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 21 - 204
Target Start/End: Complemental strand, 38882005 - 38881824
Alignment:
| Q |
21 |
gttaatgtgtgagtgagcgaaatagatggaggggagtagcaacaatttataaggaactaaaaacacatgcaagaaataaatgtgagtttaagcttatcac |
120 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
38882005 |
gttaatgtgttagtgagcgaaatagatggaggg-agtggcaacaatttataaggaactaaaaacacatgcaagaaataaatgtgagttta-gcttaccac |
38881908 |
T |
|
| Q |
121 |
aacaaacaaaatattccacccgcatatacttccttctaatgcggtgttcagttagcctagtaaaccgactcaaagtaatatata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
38881907 |
aacaaacaaaatattccacccgcatatacttccttctaatgcggtgttcagttaaccaagtgaaccgactcaaagtaatatata |
38881824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University