View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_1D_low_9 (Length: 416)
Name: NF1268_1D_low_9
Description: NF1268_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_1D_low_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 16 - 416
Target Start/End: Complemental strand, 23333847 - 23333447
Alignment:
| Q |
16 |
ggacatcacgaagttgaccgataaaattgtgtgccagaatgcagctgaagcagtactcccccaaagaggttgataagtttgttttatgtaattttttgct |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333847 |
ggacataacgaagttgaccgataaaattgtgtgccggaatgcagctgaagcagtactccccccaagaggttgataagtttgttttatgtaattttttgct |
23333748 |
T |
 |
| Q |
116 |
gttttgatatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttacctcaggaactgttgttcgtgttgctgatgagctttcccttcaagag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333747 |
gttttgatatattgtgtcatgatttaccaggaaaaatgtacacattgtcgttgcctcaggaactgttgttcgtgttgctgatgagctttcccttcaagag |
23333648 |
T |
 |
| Q |
216 |
atgcgattgctgaatacatattatgcagagcttgagaccgcaactgtaagtgattttttatatgtcaactgctttctgatgaaacaatcattataatatg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23333647 |
atgcgattgctgaatacatattatgcagagcttgagaccgcaactgtaagtgattttttatatgtcaactgctttctgatggaacaatcattataatatg |
23333548 |
T |
 |
| Q |
316 |
ctgaattacgttggacaaaatccctaattcaaatgatttcgttggcttgcttaatgtcgtcattacgaagatgcgcacgacagggcataagataaattgc |
415 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23333547 |
ctgacttacgttggacaaaatccctaattcaaatgatttcgttggcttgcttaatgtcgtcattacgaagatgcgcacgatggggcataagataaattgc |
23333448 |
T |
 |
| Q |
416 |
g |
416 |
Q |
| |
|
| |
|
|
| T |
23333447 |
g |
23333447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University