View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_2D_high_10 (Length: 242)
Name: NF1268_2D_high_10
Description: NF1268_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_2D_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 15618708 - 15618563
Alignment:
| Q |
1 |
ttcctccatgccacgagataggtagtggttggacaccctaccattcttcgagttgcgcatcaagaatcgttcctccgtgtcgtgaggtaggcagaaccta |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15618708 |
ttcctccatgccacgagataggcagtggttggacaccctaccattcttcgagttgcgcgtcaagaatcgttcctccgtgtcgtgaggtaggcagaaccta |
15618609 |
T |
|
| Q |
101 |
ggctacaaattaaatggtaagacatatacaaaaagaatagcaaataagaaag |
152 |
Q |
| |
|
|||| | |||||||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
15618608 |
ggctcc-----aaatggtaaggcatatac-aaaagaatagctaataagaaag |
15618563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 15618851 - 15618926
Alignment:
| Q |
145 |
taagaaagcgtttgtgccttttagggagggattcataggctagaaacacatgagaggtgagagtgagacaaactat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15618851 |
taagaaagcgtttgtgccttttagggagggattcataagctagaaacacatgagaggtgagagtgagacaaactat |
15618926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University