View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_2D_high_11 (Length: 229)
Name: NF1268_2D_high_11
Description: NF1268_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_2D_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 61 - 212
Target Start/End: Complemental strand, 45596441 - 45596290
Alignment:
| Q |
61 |
taaccactcgctaacacaataccattttgttataatagtttaattactcactaacacatcatcgttcataacaaattcacaagtgaaaactaaacaacaa |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596441 |
taaccactcactaacacaataccattttgttataacagtttaattactcactaacacatcatcgttcataacaaattcacaagtgaaaactaaacaacaa |
45596342 |
T |
 |
| Q |
161 |
ctaaaccagcgcagaacaaccataaataagtatgctagaatacccagtaagt |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45596341 |
ctaaaccagcgcaaaacaaccataaataagtatgctagaatacccagtaagt |
45596290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 45596545 - 45596603
Alignment:
| Q |
1 |
acaaacatattcagattataggggaagtgttgcatctatactctcccatatacatacaagtaacca |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45596545 |
acaaacatattcagattataggggaagtgttgca-------tctcccatatacatacaagtaacca |
45596603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University