View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_2D_high_8 (Length: 280)
Name: NF1268_2D_high_8
Description: NF1268_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_2D_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 23835562 - 23835472
Alignment:
| Q |
1 |
aggacttgcatttaaaggaattttaaacaccatctgtgaactttttgtaagtgaagcaaacattcaatgtgtctacgtgcgaatctgggtg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23835562 |
aggacttgcatttaaaggaattttaaacactatctgtgaactttttgtaagtgaagcaaacattcaatgcgtctacgtgcgaatctgggtg |
23835472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 179 - 266
Target Start/End: Complemental strand, 23835502 - 23835415
Alignment:
| Q |
179 |
cattcaatgagtctgcgtgcgaatctgggtgctttcaccataacttaattctttttaatgtttatgtatggtttcttctttggatgtc |
266 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23835502 |
cattcaatgcgtctacgtgcgaatctgggtgctttcaccataacttaattctttttaatgtttatgtatggtttcttctttggatgtc |
23835415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University