View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1268_2D_low_17 (Length: 375)
Name: NF1268_2D_low_17
Description: NF1268_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1268_2D_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 6 - 152
Target Start/End: Complemental strand, 9944177 - 9944021
Alignment:
| Q |
6 |
tgcaatgattctaccctaattcatgtttccttcatcaagatccattttttattcacttccatcactttcatttttctccttatggtaaaaatctgcactt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9944177 |
tgcaatgattctaccctaattcatgtttccttcatcaagatccattttttattcacttccatcactttcatttttctccttatggtaaaaatctgcactt |
9944078 |
T |
|
| Q |
106 |
----------tcactcatactttactcttttctcactcttcttagttcaacccttca |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9944077 |
tcacccaatttcactcatactttactcttttctcactcttcttagttcaacccttca |
9944021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 249 - 357
Target Start/End: Complemental strand, 9943923 - 9943815
Alignment:
| Q |
249 |
gttgtcttgttggttactcatcactgttgaactttattaattattctaatgatcatgttctgcatgcagtttactactcatgtttcatagttgatttgct |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9943923 |
gttgtcttgttggttactcatcactgttgaactttattaattaatctaatgatcatgttctgcatgcagtttactactcatgtttcatagttgatttgct |
9943824 |
T |
|
| Q |
349 |
aaatgggtc |
357 |
Q |
| |
|
||||||||| |
|
|
| T |
9943823 |
aaatgggtc |
9943815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University