View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269-Insertion-1 (Length: 220)
Name: NF1269-Insertion-1
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 59 - 220
Target Start/End: Complemental strand, 20899264 - 20899103
Alignment:
| Q |
59 |
tcttcttcaagcaaatgggagctatatacctacacatgctctgacacctaagttagcgatagacatgagacgatatgtgtatttgtaaaaagtgaactta |
158 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20899264 |
tcttctccgagcaaatgggagctatatacctacacgtgctctgacacctaagttagtgatagacatgagacgatatgtgtatttgtaaaaagtgaactta |
20899165 |
T |
|
| Q |
159 |
acttacccatgtgtgagatctggcattttatattggaggtttatggttttttcccttgtata |
220 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20899164 |
acttacccatgtatgagatatggaattttatattggaggtttatggttttttctcttgtata |
20899103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 68
Target Start/End: Original strand, 34899971 - 34900031
Alignment:
| Q |
8 |
gagatgtacttttggtccttgtactttataaaaataagttttgtttggccctcttcttcaa |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34899971 |
gagatgtacttttggtccttgtactttataaaaataagttttgtttggccctcttattcaa |
34900031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University