View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12690_low_3 (Length: 308)
Name: NF12690_low_3
Description: NF12690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12690_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 5038517 - 5038242
Alignment:
| Q |
18 |
ttttcgtggttatggtggcaattgtccattccattgaattttgttccatctatgttaagttttcatgtcttttggaaatgatgatgtcttctatgacgac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5038517 |
ttttcgtggttatggtggcaattgtccattccattgaattttgttccatctatattaagttttcatgtcttttggaaatgatgatgtcttctatgacgac |
5038418 |
T |
 |
| Q |
118 |
aagattctatgtgttgaacaattcgtgaattgaatagaattaaatcctcctcttaaaaatggtttttaaagatatcttatgggtcttttttagattttaa |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5038417 |
aagattctaagtgttgaacaattcgtgaat-----agaattaaatcctcctcttaaaaatggtttttaaagatatcttatgggtcttttttacattttaa |
5038323 |
T |
 |
| Q |
218 |
aagtgcttcgagataggccttatccttggtttgatagggtctggattgaattttatctcctcatactttctggtttctgtg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
5038322 |
aagtgcttcgagataggccttatccttggtttgatagggtttgaattgacttttatctcctcatactttctggtttttgtg |
5038242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University