View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12691_high_8 (Length: 215)

Name: NF12691_high_8
Description: NF12691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12691_high_8
NF12691_high_8
[»] chr3 (2 HSPs)
chr3 (16-196)||(50369012-50369192)
chr3 (39-202)||(50379169-50379332)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 50369192 - 50369012
Alignment:
16 aaagggcatgaaggtaaattcgtaattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgg 115  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
50369192 aaagggcatgaaggtaaattcgtaattggtggtgattttccaacttttgctagctttggtaaggcttatgtatacggaacacccgttttggagtatccgg 50369093  T
116 gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatg 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50369092 gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatg 50369012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 202
Target Start/End: Complemental strand, 50379332 - 50379169
Alignment:
39 aattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgggtttgattaaagccgcggtccat 138  Q
    ||||||||| ||||||||||| ||||||||||| |||| |||||   | || ||| | ||   ||| |||| ||| ||||||||||| |  || || ||     
50379332 aattggtggtgattttccaacgtttgctagcttgggtagggttttattgtatggatcgccaagttttgagtttccaggtttgattaaggtggcagttcac 50379233  T
139 ggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatgtgatga 202  Q
    ||||||    ||||||||||||||||||||||||||||  ||| |||||||||| ||| |||||    
50379232 ggtggtaacctgtgtgacccggataagagaccgtggggggcaggtgtgatgatggatgagatga 50379169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University