View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12691_low_11 (Length: 215)
Name: NF12691_low_11
Description: NF12691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12691_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 50369192 - 50369012
Alignment:
| Q |
16 |
aaagggcatgaaggtaaattcgtaattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369192 |
aaagggcatgaaggtaaattcgtaattggtggtgattttccaacttttgctagctttggtaaggcttatgtatacggaacacccgttttggagtatccgg |
50369093 |
T |
|
| Q |
116 |
gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50369092 |
gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatg |
50369012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 202
Target Start/End: Complemental strand, 50379332 - 50379169
Alignment:
| Q |
39 |
aattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgggtttgattaaagccgcggtccat |
138 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||| ||||| | || ||| | || ||| |||| ||| ||||||||||| | || || || |
|
|
| T |
50379332 |
aattggtggtgattttccaacgtttgctagcttgggtagggttttattgtatggatcgccaagttttgagtttccaggtttgattaaggtggcagttcac |
50379233 |
T |
|
| Q |
139 |
ggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaatgtgatga |
202 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| |||||||||| ||| ||||| |
|
|
| T |
50379232 |
ggtggtaacctgtgtgacccggataagagaccgtggggggcaggtgtgatgatggatgagatga |
50379169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University