View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12691_low_12 (Length: 208)
Name: NF12691_low_12
Description: NF12691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12691_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 7943832 - 7943997
Alignment:
| Q |
17 |
aggggctgaagatggagtttggctggagggaggatttggatatgtttggattttagatgtaaccatcaccattccattaaactggggtaaggtaaggtaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7943832 |
aggggctgaagatggagtttggctggagggaggatttggatatgtttggattttagatgtaaccatcaccattccattaaactgg----------ggtaa |
7943921 |
T |
 |
| Q |
117 |
ggtaaggtatgctatactatattctagatatctttcttataagattttattaaaaataattgtatctattttttat |
192 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7943922 |
ggtaaggtatgctatactatattccagatatctttgttataagattttattaaaaataattgtatctattttttat |
7943997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University