View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12692_low_7 (Length: 207)
Name: NF12692_low_7
Description: NF12692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12692_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 13 - 115
Target Start/End: Complemental strand, 38854069 - 38853963
Alignment:
| Q |
13 |
ggagcacagattgaataataagtggtacaaatagattactcattttgttaa----ctttagtattttctcacttggatttggtacaagttgattattcgt |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38854069 |
ggagcatagattgaataataagtggtacaaatagattactcattttgttaactgcctttagtattttctcacttggatttggtacaagttgattattcat |
38853970 |
T |
|
| Q |
109 |
catatgt |
115 |
Q |
| |
|
||||||| |
|
|
| T |
38853969 |
catatgt |
38853963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 45454854 - 45454759
Alignment:
| Q |
20 |
agattgaataataagtggtacaaatagattactcattttgttaa----ctttagtattttctcacttggatttggtacaagttgattattcgtcat |
111 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
45454854 |
agattgaataataagtagtactaatagattactcattttgttaactgcctttattattttctcacttggatttagtacaaattgattattggtcat |
45454759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University