View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12693_high_3 (Length: 401)
Name: NF12693_high_3
Description: NF12693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12693_high_3 |
 | |
|
| [»] scaffold1419 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 104 - 397
Target Start/End: Original strand, 32470453 - 32470746
Alignment:
| Q |
104 |
aacactgttgctgaaactgtttaaagggtatggcacaagaatcacaggcaatggatccgcacaagaatgaagttattcgtttagagcgtgaatctgttat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32470453 |
aacactgttgctgaaactgtttaaagggtatggcacaagaatcacaggcaatggatccgcacaagaatgaagttattcgtttagagcgtgaatctgttat |
32470552 |
T |
|
| Q |
204 |
tccaattctcaaacctagactcatcatgacattggcaaatcttattggtataattctgtatatgcccttttgaatttctttttatgttgtgttgaattca |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32470553 |
tccaattctcaaacctagactcatcatgacattggcaaatcttattggtataattctgtatatgcccttttgaatttctttttatgttgtgttgaattca |
32470652 |
T |
|
| Q |
304 |
tatttgtagaagcatgtttagggtatactgttttgtaatttttggttgttattgttgttatagtgattaatgattagccttcagtgaacgagca |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
32470653 |
tatttgtagaagcatgtttagggtatactgttttgtaatttttggttgttattgttgttatagtgattaatgattagccttcaatgaaagagca |
32470746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 32470355 - 32470418
Alignment:
| Q |
5 |
ttttttcataaacctctctgtttcttacaccttttatccatttacctcataaaaacgcttcctt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32470355 |
ttttttcataaacctctctgtttcttacaccttttatccatttacctcataaaaacgcttcctt |
32470418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1419 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold1419
Description:
Target: scaffold1419; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 104 - 180
Target Start/End: Complemental strand, 1412 - 1336
Alignment:
| Q |
104 |
aacactgttgctgaaactgtttaaagggtatggcacaagaatcacaggcaatggatccgcacaagaatgaagttatt |
180 |
Q |
| |
|
|||||| | ||| ||||| ||||||||||||| ||||||||||||||| ||||||||| | |||||||| ||||||| |
|
|
| T |
1412 |
aacactatcgctcaaactatttaaagggtatgacacaagaatcacaggtaatggatccacgcaagaatggagttatt |
1336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 166 - 254
Target Start/End: Original strand, 10532260 - 10532348
Alignment:
| Q |
166 |
aagaatgaagttattcgtttagagcgtgaatctgttattccaattctcaaacctagactcatcatgacattggcaaatcttattggtat |
254 |
Q |
| |
|
||||| ||||| ||||| |||| ||||||||||| ||||||||| | ||||||| ||| |||| ||||||| ||||||||| |||| |
|
|
| T |
10532260 |
aagaaagaagtgattcgaatagaacgtgaatctgtcattccaattttgaaacctaagctcttcattgcattggctaatcttattagtat |
10532348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University