View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12694_high_15 (Length: 255)
Name: NF12694_high_15
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12694_high_15 |
 |  |
|
| [»] scaffold0203 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0203 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: scaffold0203
Description:
Target: scaffold0203; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 43 - 237
Target Start/End: Original strand, 28855 - 29057
Alignment:
| Q |
43 |
ctacatacaaatgatctgaatatcatcaaatctcatattatattactatcgatcaggtcaaacaattcaaccgatgtatatcacatatacaaaatcgaaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28855 |
ctacatacaaatgatctgaatatcatcaaatctcatattatattactatcgatcaggtcaaacaattcaaccgatgtatatcacatatacaaaatcgaaa |
28954 |
T |
 |
| Q |
143 |
ataatattccaagagcactgaatcatattcaagcgatgataatttaattttgaatttaatgattcaatc--------agctctgataccactgaagggat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28955 |
ataatattccaagagcactgaatcatattcaagcgatgataatttaaatttgaatttaatgattcaatcacaaccgaagctctgataccactgaagggat |
29054 |
T |
 |
| Q |
235 |
ttt |
237 |
Q |
| |
|
||| |
|
|
| T |
29055 |
ttt |
29057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0203; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 28774 - 28816
Alignment:
| Q |
1 |
gaacataaaaacgtaaggatgatgacaaagttgaaacaatttc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28774 |
gaacataaaaacgtaaggatgatgacaaagttgaaacaatttc |
28816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University