View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12694_high_20 (Length: 247)
Name: NF12694_high_20
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12694_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 27154914 - 27155151
Alignment:
| Q |
1 |
ataaagcaatgcatgcaaaatcagggagttctcattcctctggccacacgcccggtgaaatagctgcttatgccattgcagcagttttggttgtcgccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27154914 |
ataaagcaatgcatgcaaaatcagggagttctcattcctctggccacacgcccggtgaaatagctgcttatgccattgccgcagttttggttgtcgccat |
27155013 |
T |
 |
| Q |
101 |
agttgtggcagctgnnnnnnn-gcgtttaggaagaagaaaacgaaaggggatgcatatgttggaccctatataccaccccctggtagcttccacattaaa |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27155014 |
agttgtggcagctgttttttttgcgtttaggaagaagaaaacgaaaggggatgcatatgttggaccctatataccaccccctggtagcttccacattaaa |
27155113 |
T |
 |
| Q |
200 |
tcaggtaatgattttgtctcaattttatagttattcat |
237 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27155114 |
tcaagtaatgattttgtctcaattttatagttattcat |
27155151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University