View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12694_low_11 (Length: 342)
Name: NF12694_low_11
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12694_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 331
Target Start/End: Original strand, 21395797 - 21396110
Alignment:
| Q |
18 |
atcaatcgccatgttctttgcatatgggatcatttaaatattgaatgcagaatattttatttgccagcttaaccacatgctaatgttctgagatccgacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21395797 |
atcaatcgccatgttctttgcatatgggatcatttaaatattgaatgcagaatattttatttgccagcttaaccacatgctaatgttctgagatccgacc |
21395896 |
T |
|
| Q |
118 |
atttcggtcataataaatttcttgtctttattatttgattttccttatctgaaaattgcttttacaagtacaaacatttttatctttatgtgcctaaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21395897 |
atttcggtcataataaatttcttgtctttattatttgattttccttatctgaaaattgcttttacaagtacaaacatttttatctttacgtgcctaaaat |
21395996 |
T |
|
| Q |
218 |
ccaatcttcatgacttcaatcacgttattttgttttatgtatacttttttcccttgttattgatagatttagattgttttatgtatagtttgatttaaac |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21395997 |
ccaatcttcatgacttcaatcacgttattttgttttatgtatacttttttcccttgttattgataaatttagattgttttatgtatagtttgatttaaac |
21396096 |
T |
|
| Q |
318 |
ttcttccctttcat |
331 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21396097 |
ctcttccctttcat |
21396110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University