View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12694_low_13 (Length: 315)
Name: NF12694_low_13
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12694_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 42012002 - 42012291
Alignment:
| Q |
18 |
gaagcatatgaaattctatttaataataaacagcaaggatcggatatagtacaatcttaggatatgtgatttctcatttatatcacatgcaagtttatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42012002 |
gaagcatatgaaattctatttaataataaacagcaaggatcggatatagtacaatctttggatatgtgatttctcatttatatcacatgcaagtttatct |
42012101 |
T |
 |
| Q |
118 |
ttgatctaatattgcaggtaaaaagtgtggagccaaaggaagctctgcgccttcagaaagaaaataattttgtgattcttgatgtaaggccagaagcaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42012102 |
ttgatctaatattgcaggtaaaaagtgtggagccaaaggaagctctgcgccttcaaaaagaaaataattttgtgattcttgatgtaaggccagaagcaga |
42012201 |
T |
 |
| Q |
218 |
gttcaaggaggttagtgaacaagttttacaagccttgttttccagctcctatgtgcctgtacattcatgttgcattttctgtgtctctct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42012202 |
gttcaaggaggttagtgaacaagttttacaagccttgttttccagctccaatgtgcctgtacattcatgttgcattttctgtgtctctct |
42012291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University