View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12694_low_19 (Length: 250)
Name: NF12694_low_19
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12694_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 21396205 - 21396443
Alignment:
| Q |
1 |
caataaattataattattgggtctttgtttattatcaccttttctaattttttaatatgagctaccctttctactcaatctaagcttaattatggccagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21396205 |
caataaattataattattgggtctttgtttatcatcaccttttctaattttttaatatgagctaccctttctactcaatctaagcttaattatggctagg |
21396304 |
T |
 |
| Q |
101 |
ggacacatttcagtattcagggtagttgtttttgcatgaacttcaagatcctcatgatgtttttagaattatgctagttatcccttgtttgtc-ttttta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21396305 |
ggacacatttcagtattcagggtagttgtttttgcatgaacttcaagatcctcatgatgtttttagaattatgctagttatcccttgtttgtctttttta |
21396404 |
T |
 |
| Q |
200 |
tacctcccacatacatttctaattagactttaacttcat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21396405 |
tacctcccacatacatttctaattagactttaacttcat |
21396443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University