View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12694_low_24 (Length: 239)

Name: NF12694_low_24
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12694_low_24
NF12694_low_24
[»] chr2 (2 HSPs)
chr2 (1-165)||(31048655-31048819)
chr2 (189-223)||(31048597-31048631)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 31048819 - 31048655
Alignment:
1 atcttccaagttccaactagtgcaatgccctacgaagctagtacgagggactaggcacaccnnnnnnngatgctgcagttgtaaagcaaagaatattttc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
31048819 atcttccaagttccaactagtgcaatgccctacgaagctagtacgagggactaggcacaccaaaaaaagatgctgcagttgtaaagcaaagaatattttc 31048720  T
101 cacacgttgtatatagccccccttacctctttgtcatcgaatttactacataggattatcggttc 165  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
31048719 tacacgttgtatatagccccccttacctctttgtcatcgaatttactacataggatgatcggttc 31048655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Complemental strand, 31048631 - 31048597
Alignment:
189 cattccatactaaactagtagtcacctgactaaag 223  Q
    |||||||||||||||||||||||||||||||||||    
31048631 cattccatactaaactagtagtcacctgactaaag 31048597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University