View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12694_low_24 (Length: 239)
Name: NF12694_low_24
Description: NF12694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12694_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 31048819 - 31048655
Alignment:
| Q |
1 |
atcttccaagttccaactagtgcaatgccctacgaagctagtacgagggactaggcacaccnnnnnnngatgctgcagttgtaaagcaaagaatattttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31048819 |
atcttccaagttccaactagtgcaatgccctacgaagctagtacgagggactaggcacaccaaaaaaagatgctgcagttgtaaagcaaagaatattttc |
31048720 |
T |
 |
| Q |
101 |
cacacgttgtatatagccccccttacctctttgtcatcgaatttactacataggattatcggttc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31048719 |
tacacgttgtatatagccccccttacctctttgtcatcgaatttactacataggatgatcggttc |
31048655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Complemental strand, 31048631 - 31048597
Alignment:
| Q |
189 |
cattccatactaaactagtagtcacctgactaaag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31048631 |
cattccatactaaactagtagtcacctgactaaag |
31048597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University