View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12695_high_6 (Length: 207)

Name: NF12695_high_6
Description: NF12695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12695_high_6
NF12695_high_6
[»] chr7 (1 HSPs)
chr7 (12-193)||(46680072-46680253)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 46680253 - 46680072
Alignment:
12 aacctgtggagttggtgaagaaagaggtggaatttctgcatccgtggccggaatggattcaattgatggagagattggttcatcagaattattttgatca 111  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46680253 aacctgtggagttggtgaagaaagaggtggaatttgtgcatccgtggccggaatggattcaattgatggagagattggttcatcagaattattttgatca 46680154  T
112 tagaaggaaagatgaggataaaatggtgcaggatttagggtttgattcatctgagattgtacacgatgaagggcttgatttt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46680153 tagaaggaaagatgaggataaaatggtgcaggatttagggtttgattcatctgagattgtacacgatgaagggcttgatttt 46680072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University