View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12698_high_15 (Length: 324)
Name: NF12698_high_15
Description: NF12698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12698_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 26 - 314
Target Start/End: Complemental strand, 43200076 - 43199788
Alignment:
| Q |
26 |
aagtagtacatgcattagagcacaatatacttacaatggtacttggtacagaatagctagcagagtaaagtatgggctaaatcagattaatccaaatcaa |
125 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43200076 |
aagtagtacatgcattagagaaccatatacttacaatggtacttggtacagaatagctagcagagtaaagtatgggctaaatcagattaatccaaatcaa |
43199977 |
T |
 |
| Q |
126 |
aactgaaagattatactccttctagtaccttaacaaattaaattacacccaaatatcgactaggcttagtcaatgggaatcacatgccatatggcacgct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43199976 |
aactgaaagattatactccttctagtaccttaacaaattaaattacacccaaatatcgactaggcttagtcaatgggaatcacatgccatatggcacgct |
43199877 |
T |
 |
| Q |
226 |
tagctaattcactgcacgtgcagtgcacgtcattatgtaacaaaattttctaccctcttcataaggaaaatgaagtcctttattctgtg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43199876 |
tagctaattcactgcacgtgcagtgcacgtcattatgtaacaaaattttctaccctcttcatcaggaaaatgaagtcctttattctgtg |
43199788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University