View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12698_high_18 (Length: 304)
Name: NF12698_high_18
Description: NF12698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12698_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 286
Target Start/End: Complemental strand, 16013064 - 16012793
Alignment:
| Q |
14 |
cacagagttcgagcaagtgtgccctacgtctccgacaatagagtggctactgtagtttctactatgaaactcttacagttgcagattacaagttatgttt |
113 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
16013064 |
cacagagttcgagcaagtgtgcc-tacgactccgacaatagagtggctactgtagtttctactatgaaattcttgcagttgcagattacaagttatgttt |
16012966 |
T |
|
| Q |
114 |
aaatactacggtcaagtttacccttaaattccaatgcgaggggcttcgcccactataccccaaccctcctaatcgtaacccaacatatgtatgggccaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16012965 |
aaatactacggtcaagtttacccttaaattgcaatgcgagggacttcgcccactataccccaaccctcctaatcttaacccaacatatgtatgggccaaa |
16012866 |
T |
|
| Q |
214 |
cttaagcggaaggcaatctagctgcactacgctcgttgcagtttcagctccattcactccgctacgctattct |
286 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16012865 |
cttaagcggaaggcactctagctgcactacgctcgttgcagtttcagctccattcacttcgctacgctattct |
16012793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 95 - 134
Target Start/End: Original strand, 13855051 - 13855090
Alignment:
| Q |
95 |
cagattacaagttatgtttaaatactacggtcaagtttac |
134 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
13855051 |
cagattacaacttatgtttaaatactacggtctagtttac |
13855090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University