View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12698_high_21 (Length: 263)
Name: NF12698_high_21
Description: NF12698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12698_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 7175716 - 7175481
Alignment:
| Q |
12 |
aagcaaaggttgcaaatttaaggcatttaaggtgtgtggaaggagttgaaaatgatgaagaatttgttgctacaagacatattgttgggacaagaggtta |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175716 |
aagcaaaggttgcaaatttaaggcatgtaaggtgtgtggaagaagttgaaaatgatgaagaatttgttgctacaagacatattgttgggacaagaggtta |
7175617 |
T |
 |
| Q |
112 |
catggctcctgagtatttggaaaatggtcttgtttctacaaagcttgatgtgtatgcatttggtattttgatgttggaaattattacaggaaaagaggtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175616 |
catggctcctgagtatttggaaaatggtcttgtttctacaaagcttgatgtgtatgcatttggtattttgatgttggaaattattacaggaaaagaggtt |
7175517 |
T |
 |
| Q |
212 |
ggttttatgatatcaaaagataatgagaatttgttg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175516 |
ggttttatgatatcaaaagataatgagaatttgttg |
7175481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University