View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12698_low_15 (Length: 336)
Name: NF12698_low_15
Description: NF12698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12698_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 77 - 293
Target Start/End: Complemental strand, 2736247 - 2736031
Alignment:
| Q |
77 |
aaccaaaacaataagctatattattaaaaaattcctttcaactcattcaaatatattaaattcatccttgcaacgcgtaggttttcatctagttctcata |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2736247 |
aaccaaaacaataagctatattattaaaaaattcctttcaactcattccaatatattaaattcatccttgcaacgcgtaggttttcatctagttctaata |
2736148 |
T |
 |
| Q |
177 |
ttattaagaaggggcacagtggcatattcatgtttttgaagttcaaagcttgtctggggatttttgtatgtttttcttgtagcttaagaaactcttgtag |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2736147 |
ttattaagaaggggcacagtggcatattcatgtttttgaagttcaaagcttgtctggggatttttgtatgtttttcttgtagcttaagaaactcttggag |
2736048 |
T |
 |
| Q |
277 |
gtttagtttgtttcatg |
293 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
2736047 |
gtttagattgtttcatg |
2736031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 2741707 - 2741630
Alignment:
| Q |
1 |
tcttcatatcactctgttcctttgtttcttctctttttatcaccaagctatcaaactgagatggtaagattctaagaa |
78 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2741707 |
tcttcatatcactgtgttcctttgtttcttctctttttatcaccaagctatcaaactgagatggtaagattttaagaa |
2741630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University