View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12698_low_20 (Length: 301)
Name: NF12698_low_20
Description: NF12698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12698_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 5042201 - 5041930
Alignment:
| Q |
18 |
cttggattggtgctctagttcttgcagctattcagctgcatctagtagtagaattctggtaagatatttagttcaaaacttacttttctacttcatatag |
117 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042201 |
cttggatttgtgttctagttcttgcagctattcagctgcatctagtagttgaattctggtaagatatttagttcaaaacttacttttctacttcatatag |
5042102 |
T |
 |
| Q |
118 |
tagtttagataaactatgaatcactggtctggacacaaacaccagac---acgttactgacactcacatgttgacacttgt-nnnnnnnggtgtttaatt |
213 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
5042101 |
ttgt---gataaactatgaatcactggtctggacacaaacaccagacacgacgttactgacactcatatgttgacacttgtaaaaaaaaggtgtttaatt |
5042005 |
T |
 |
| Q |
214 |
gattcatgtgtgctagtatggtgttagtgttcgtgtcaaacactaaacacatctacgatctgaaatatctgtgct |
288 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5042004 |
gattcatgtgtgctagtatcgtgttagtgttagtgtcagacactaaacacatctacgatctgaaatatctatgct |
5041930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University