View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12699_low_3 (Length: 401)
Name: NF12699_low_3
Description: NF12699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12699_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 18 - 393
Target Start/End: Complemental strand, 54014871 - 54014496
Alignment:
| Q |
18 |
ttttcttactagaaatcgaaggattcttcaacaaggtgttgatttcaagcagattgacaaagaatgggactggtaattcaacattttatcatttaacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014871 |
ttttcttactagaaatcgaaggattcttcaacaaggtgttgatttcaagcagattgacaaagaatgggactggtaattcaacattttatcatttaacaaa |
54014772 |
T |
 |
| Q |
118 |
gtatattatatatgctgaaaattatttgttgattattgatttatatcataattttttgaaacagggacaatttcttgattcttcaaacactcgttgctac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54014771 |
gtatattatatatgctgaaaattatttgttgattattgatttatatcataattttttgaaacagggacaatttcttgattcttcaaacacttgttgctac |
54014672 |
T |
 |
| Q |
218 |
cttagtttcctatattttcccatttcttcagcatcttcctctatggaatataaaaggtattattgttgccatgattctacatgtgggagtttcagagcca |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54014671 |
cttagtttcctatattttcccatttcttcagcatcttcctctatggaatgtaaaaggtattattgttgctatgattctacatgtgggagtttcagagcca |
54014572 |
T |
 |
| Q |
318 |
ctttattattgggtacataagaaatttcatggagattatcttttcaaaaactatcactctcttcatcattcatctc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014571 |
ctttattattgggtacataagaaatttcatggagattatcttttcaaaaactatcactctcttcatcattcatctc |
54014496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University