View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269_low_10 (Length: 311)
Name: NF1269_low_10
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 42 - 236
Target Start/End: Complemental strand, 29579130 - 29578936
Alignment:
| Q |
42 |
gtccttaacatccactgaatcctccaatggaattcatgcgtgttttggttgttctaactattcattttgggagaccattctgcaccgccccaatcaaggg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29579130 |
gtccttaacatccactgaatcctccaatggaattcatgcgtgtttgtgttgatctaactattcattttgggagaccattctgcaccgccccaatcaaggg |
29579031 |
T |
|
| Q |
142 |
tgggtctatctatatactgctctacatctgatcttacctcaatctcgttttcaatattcattagaaagtcttcaaaaaaggcatacattaggcag |
236 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29579030 |
tgggtctatctaaatactgctctacatctgatcttacctctaactcgttttcaatattcattagaaagttttcaaaaaaggcatacattaggcag |
29578936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University