View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269_low_11 (Length: 295)
Name: NF1269_low_11
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 133 - 225
Target Start/End: Original strand, 12153056 - 12153148
Alignment:
| Q |
133 |
taaagatcatgaagatactttatagccaaactcgctggtcattttaatgtaacattcccatgacacctttgttgccatcccaaatcatcttac |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12153056 |
taaagatcatgaagatactttatagccaaactcgctggtcattttcatgtaacattcccatgacaactttgttgccatcccaaatcatcttac |
12153148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 81
Target Start/End: Original strand, 12152975 - 12153004
Alignment:
| Q |
52 |
attattcttagtgaaaggtggagaatgtga |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12152975 |
attattcttagtgaaaggtggagaatgtga |
12153004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University