View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269_low_16 (Length: 259)
Name: NF1269_low_16
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 27125670 - 27125899
Alignment:
| Q |
1 |
tccgaatgaaaaccactatacttaacggaaagcattacaaaccaaaaactgttatgcagatcatagaccatcattttgctatgtctatgcttattttaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27125670 |
tccgaatgaaaaccactatacttaacggaaagcattacaaaccaaaaactgttatgcagatcatagaccatcattttgcaatgtctatgcttattttaag |
27125769 |
T |
|
| Q |
101 |
aggatttagagaaaatgaaccgcgatgatgtacaagatgcattgtagggtatgaaccctttccttttgacgccttagaaatcttaaaaggacactgaggg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27125770 |
gggatttagagaaaatgaaccacgatgatgtacaagatgcattgtagggtatgaaccctttccttttgacgccttagaaatcttaaaaggacactgaggg |
27125869 |
T |
|
| Q |
201 |
tgaaattttgaagtctatatcccacagttc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27125870 |
tgaaattttgaagtctatatcccacagttc |
27125899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University