View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269_low_18 (Length: 257)
Name: NF1269_low_18
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 40 - 101
Target Start/End: Complemental strand, 2260241 - 2260180
Alignment:
| Q |
40 |
cataaactgattcaaatcaatccccagtttcttatagtccataaactctctctccatcctga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2260241 |
cataaactgattcaaatcaatccccagtttcttatagtccataaactctctctccatcctga |
2260180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 2260257 - 2260287
Alignment:
| Q |
1 |
attggtgcaaaaagagtgactaatgtctgtg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2260257 |
attggtgcaaaaagagtgactaatgtctgtg |
2260287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University