View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269_low_19 (Length: 254)
Name: NF1269_low_19
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 103 - 254
Target Start/End: Original strand, 54470080 - 54470231
Alignment:
| Q |
103 |
atatgcaatatagtgacttagtggattgacacggaagatgaatatattacatgttagaaaaacaaaattgatggaggttatatttaagaaccaaagtgct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54470080 |
atatgcaatatagtgacttagtggattgacacggaagatgaatatattacatgttagaaaaacaaaattgatggaggttatatttaagaactaaagtgct |
54470179 |
T |
|
| Q |
203 |
tcagttatggagtcctccctcgaggggcttcttaaaaatcaacgtagattct |
254 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54470180 |
tcagttgtggagtcctccctcgaggggcttcttaaaaatcaacgtagattct |
54470231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University