View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1269_low_5 (Length: 364)
Name: NF1269_low_5
Description: NF1269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1269_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 126 - 271
Target Start/End: Complemental strand, 21113424 - 21113279
Alignment:
| Q |
126 |
ctatgtcatgatatgtccacgagcattcaatttggattatgaaattgatgattttgtcaacctctataattggaaggatatattttgttttaacaggaat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21113424 |
ctatgtcatgatatgtccacgagcattcaatttggattatgaaattgatgattttgtcaacctctataattggaaggatatattttgttttaacaggaat |
21113325 |
T |
|
| Q |
226 |
aatttaaaaaatatcgggtgtattatactattgggataggtgtagt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21113324 |
aatttaaaaaatatcgggtgtattatactattgggataggtgtagt |
21113279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 25 - 60
Target Start/End: Complemental strand, 21113525 - 21113490
Alignment:
| Q |
25 |
gttgtttggttttgtttgtgttaggattacttcatc |
60 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21113525 |
gttgtttggttttgtttgtgttagggttacttcatc |
21113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 260 - 349
Target Start/End: Original strand, 19305491 - 19305579
Alignment:
| Q |
260 |
gataggtgtagtttttagtgagttttgttgaggtgcttgtttgattagtgtaatgggtggcttgtttgtattaggggtttttgtttggtt |
349 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | || |||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19305491 |
gatagctgtagtttttagtgagttttgttgaagggcctgtttgattagtgtaacgggtggcttgtttgtattagggg-ttttgtttggtt |
19305579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University