View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270-Insertion-3 (Length: 199)
Name: NF1270-Insertion-3
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270-Insertion-3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 8 - 199
Target Start/End: Original strand, 45088660 - 45088851
Alignment:
| Q |
8 |
taagggccctcaaaatttcagtttaagggcactcaaaatttcatcaagaaaatgtcctaccataagtttaactgttaagcaaatatccattacatctctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45088660 |
taagggccctcaaaatttcagtttaagggcactcaaaatttcatcaagaaaatgtcctaccataagtttaactgttaagcaaatctccattacatctctt |
45088759 |
T |
|
| Q |
108 |
ataaaaacatgtatgaatcaaaagtttttaaggttgaaacggagccaaagggttaaaatgcaaggtgggataaaacaaaccaaacatttgag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45088760 |
ataaaaacatgtatgaatcaaaagtttttaaggttgaaacgaagccaaagggttaaaatgcaaggtgggataaaacaaaccaaacatttgag |
45088851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University