View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1270-Insertion-6 (Length: 205)
Name: NF1270-Insertion-6
Description: NF1270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1270-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 205
Target Start/End: Original strand, 44857131 - 44857330
Alignment:
| Q |
6 |
catatataactgaccacaacaaaagccactttcatattataaccaaccacatcaaaacgttacacataatttttagtttgataaattagacgcgattgag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857131 |
catatataactgaccacaacaaaagccactttcatattataaccaaccacatcaaaacgttaaacataatttttagtttgataaattagacgcgattgag |
44857230 |
T |
|
| Q |
106 |
gcattgttttgagtagatggtaaatgcttttgtgccatctgatacacattcattgggtagcaaatagaaggtggtccagtaaaagccttactagccataa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857231 |
gcattgttttgagtagatggtaaatgcttttgtgccatctgatacacattcattgggtagcaaatagaaggtggtccagtaaaagccttactagccataa |
44857330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University